8 kb [26]    pET-DEST42 Apr, Cmr, C-terminal 6×His and V5 epitope

8 kb [26]    pET-DEST42 Apr, Cmr, C-terminal 6×His and V5 epitope Invitrogen    pDONR221 Kmr, gateway entry vector Gmr, N-terminal GST Invitrogen    pBBR1MCS-3 Tcr, mob, broad host range cloning vector

[36]    pBBR3DEST42 Cmr Tcr, C-terminal 6×His and V5 epitope This study    pKm-0347 pKnock-Km selleck containing 262-bp hfq internal fragment click here for insertional mutant construction This study    p42-0347 pBBR3DEST42 containing ZM4 gene ZMO0347 This study PCR Primers        hfq_MF cggagagatggtcagtcaca 262-bp    hfq_MR ttcttgctgctgcataatcg      hfq_CF ggggacaagtttgtacaaaaaagcaggcttcgaaggagatagaATGGCCGAAAAGGTCAACAATC 483-bp    hfq_CR ggggaccactttgtacaagaaagctgggtcATCCTCGTCTCGGCTTTCTG      hfq_OCF Caaagcttgagctcgaattcatttttgccgtggtagttgc 1050-bp    hfq_OCR caggtacctctagaattcaccactcaatcctcgtctcg   hfq_MF and hfq_MR are primers used for insertional mutant construction using pKnock mutagenesis system. Hfq_OCF and Hfq_OCR are primers for mutant

confirmation. Hfq_CF and Hfq_CR are primers used to clone the hfq gene into low copy number Gate-Way compatible plasmid pBBR3DEST42 for complementation, which results in a plasmid called p42-0347. Z. mobilis hfq contributes to pretreatment inhibitor tolerance Pretreatment inhibitors had negative effects on Z. mobilis growth: the growth of Z. mobilis strains was reduced in the presence of acetate, vanillin, furfural, or HMF with increased lag phases and/or slower growth rates and/or final bacterial cell densities depending on the respective condition and strain (Table 2, 3; Fig. 1, 2). Among the different forms of acetate Evofosfamide price counter-ions tested, sodium acetate had the most inhibitory

effect on wild-type Z. mobilis growth. This was followed by potassium acetate and ammonium acetate and sodium chloride had the least negative influence on wild-type Z. mobilis growth (Table 2; Fig. 1). Wild-type ZM4 growth was completely inhibited when RM medium was amended with 195 mM sodium acetate (Table 2; Fig. 1C) in keeping with previous reports [13]. Among the pretreatment inhibitors of vanillin, furfural, and HMF, vanillin had the most inhibitory effect on Z. mobilis and HMF the least (Table 3). many Z. mobilis took longer to complete active growth and reach the stationary phase, which was about 16, 19 or 21 h in the presence of HMF, furfural or vanillin, respectively, compared to 11 h without any inhibitor present in the medium (Fig. 2). Table 2 Growth rate and final cell density of different Z. mobilis strains in the absence or presence of different sodium and acetate ions.     ZM4 AcR AcRIM0347 AcRIM0347 (p42-0347) ZM4 (p42-0347) Growth rate (hour -1 ) RM 0.42 ± 0.01 0.39 ± 0.01 0.32 ± 0.003 0.33 ± 0.002 0.38 ± 0.003   RM (NaCl) 0.24 ± 0.008 0.29 ± 0.005 0.21 ± 0.008 0.22 ± 0.009 0.25 ± 0.008   RM (NH 4 OAc) 0.20 ± 0.008 0.19 ± 0.005 NA 0.22 ± 0.002 0.19 ± 0.007   RM (Kac) 0.15 ± 0.004 0.12 ± 0.000 NA 0.09 ± 0.003 0.12 ± 0.

Comments are closed.