After extraction, DNA was precipitated with 0.6 volumes of isopropanol, MK1775 washed twice with 70% v/v ethanol, allowed to dry, and resuspended in 50 μl dH2O. Southern blot analysis In order to identify mutants with insertions in podJ and pleC, Southern blot analysis was used to analyze the positions of the mariner insertions in mutants with phenotypes similar to podJ and pleC. Probes were prepared with DIG-High Prime DNA Labeling and Detection Starter Kit I (Roche). A 2.1 kb podJ probe was PCR amplified from CB15 genomic DNA using primers 5podJ2508 and 3podJ4522 (Table 3) and probed
against SfiI-digested chromosomal DNA. A 2.9 kb pleC probe was PCR amplified from CB15 genomic DNA using primers pleCfor and pleCrev (Table 3) and probed against XhoI-digested chromosomal DNA. Table 3 Primers used in this study 5podJ2508 GCCTGGTGGGCCGCTCTGAT 3podJ4522 CGGTTGGGGACATCGTCCCC pleCfor ATCGTCGTCGACTTGCCCGCGCCC pleCrev GCCAGCAAGGCGCTCGGCTGACGA pBGST181 ATGGCAAGATCCTGGTAT pBGST182 CGATAATGTCGGGCAATC MarRseq CGGGTATCGCTCTTGAAGGGA M134UP GGACGAGTCGGAATTCCAGACCG M134DN GCCTTCAGACTCTAGAATGAGTTCG CtrAlacUp CAGAACGCCGGAATTCCGTCCGTGA For strains of interest that did
not have insertions in podJ or pleC, genomic DNA (~3 μg) was digested with PstI and separated on an agarose gel. DNA was excised from the gel area found to include the band seen by Southern analysis using a probe for the kanamycin resistance gene. The DNA was isolated from the gel using XL765 the Qiaquick Gel Extraction kit (Qiagen) and ligated to PstI-digested pKSII+ (Stratagene) overnight at 16°C. The ligation was electroporated
into E. coli strain DH5α (F’, ϕ80dlacZΔM15, Δ(lacZYA-argF)U169, endA1, recA1, hsdR17 (rk-, mk+), deoR, thi-1, supE44, λ-, gyrA96, relA1). AmpR KanR colonies were isolated, and plasmid DNA was purified. DNA sequencing Plasmids were sequenced with primer MarRseq (Table 3) using Big Dye version 3.1 (Applied Biosystems), and run on pentoxifylline an ABI3730 DNA Analyzer at the Indiana Molecular Biology Institute (Indiana University). The transposon insertion site was identified in the sequence, and the gene was identified by a Basic Local Alignment Search Tool (BLAST) search against the C. crescentus genome (TIGR – http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&BLAST_SPEC=MicrobialGenomes_155892&DB_GROUP=AllMG). Characterization of the YB3558 mutant Visual analysis Cultures of YB3558 were grown overnight in PYE with kanamycin, diluted to an OD600 of approximately 0.15, and allowed to grow to an OD600 of 0.5-0.6, then observed using 100X Plan Apo objective on a Nikon Eclipse E800 microscope. Images were captured using a Princeton Instruments 1317 cooled CCD camera and processed with Metamorph v. 4.5 (Universal Imaging Corporation).