Statistical analysis All data are expressed as mean ± SEM. Statistical analysis was performed by Student’s t-test or Mann Whitney Ranks sum Test using Sigma plot 11 (SSP Science, Chicago, IL, USA). The accepted level of significance was set at P < 0.05. Acknowledgements The authors thank Prof Mikulitis (Medizinische Universität Wien) for the kindly providing of cell line M4-1 HSC PR-171 concentration line and Dr. R. Geßner (Department für Chirurgie, Universität Leipzig) for providing the anti-mouse LI-cadherin antibody. We are grateful for fruitful discussions with Belinda Knight and thank her for providing mouse liver slides. We thank Ms. Renate Bittner, Ms. Doris Mahn and Mr. Frank Struck for technical assistance.

This study was SB431542 nmr supported by Interdisciplinary Centre for Clinical Research at the Medical Faculty of the University of Leipzig (01KS9504, Project C1), by Sächsisches Ministerium für Wissenschaft und Kultur (SMWK 4-7531.50-02-0361-07/2) and by the German Federal Ministry for Education and Research (BMBF) within the program ‘Systems of click here Life -Systems Biology’ HepatoSys (FKZ 0313081F). Electronic supplementary material Additional file 1: Expression of cadherins confirms effectiveness of CDE diet conditions. A Q-RT-PCR

screen (A) verified the over-expression of E-cadherin in CDE diet mice compared to untreated controls. Remarkably, LI-cadherin the embryonal expressed liver cadherin was even strongerly increased. Statistically significant differences P < 0.05 (Mann Whitney ranks sum test) are indicated by an asterisk. Immunohistochemistry with anti-LI-cadherin antibody (B, B') demonstrates the re-expression of LI-cadherin in hepatocytes of CDE treted mice (B'). LI-cadherin is not detectable in normal adult mouse liver (B). Bar = 50 μm. (TIFF 1 MB) Additional

file 2: M2-Pk demonstration dipyridamole in livers of CDE treated mice. Immunohistochemistry with anti-M2-Pk (DF4, Schebo GmbH, Germany, A) and anti-M2-Pk (Cell Signaling, USA, A’) Smooth muscle cells are indicated by white arrows. Bar = 50 μm. (TIFF 2 MB) Additional file 3: cDNA Sequence of M-Pk and primers for M-Pk quantification and sequencing. M2-Pk and M1-Pk have the same sequence except for exon 9. Exon 8 and exon 10 are highlighted in gray. The first line shows the shared sequence of M1- and M2-Pk and the second line shows the different sequence of M1-Pk in exon 9. Primers used for sequencing of RT-PCR-products of cell lines and isolated cells were marked M-Pk-up and M-Pk-down. For real time quantification of total M-Pk primer pair 1 (M-Pk-f1 (gcatcatgctgtctggagaa and M-Pk-down) was used. M2-Pk was quantified with primer pair 3 (upper de Luis-primer and M-Pk-down). M1-RT-PCR was done with primer pair 4 (M1-f-neu and M-Pk-down), primer pair 5 (M1-rev-neu and M-Pk-forward) and primer pair 6 (M1-f-512 up and M1-down 715).