What of the future? There is growing awareness CDK inhibitor of the emerging gap between fish supply and demand in several Pacific island nations [1] and [28], with inland aquaculture considered one of three options to fill this gap, and with

tilapia receiving particular attention [31]. Such analyses have to date been largely macro-level, with limited attention to other factors determining food and nutrition security; for example the differences between inland and coastal populations explored in this study, or intra-household distribution, a key factor in addressing under-nutrition in children [38]. The research indicates that Mozambique tilapia has a high degree of acceptability, but is there a role for a farmed supply? Mozambique tilapia farming systems in Solomon Islands are low in productivity, supplying few fish, although there may be opportunities for improvement. Whilst Mozambique tilapia is widely considered in Asia and the Pacific as a poorly performing aquaculture Target Selective Inhibitor Library concentration fish

due to its slow growth rate and early sexual maturity [43] and [51] small fish per se are clearly not a constraint for consumers in Solomon Islands, and there may be opportunities for productive culture of small fish. Such systems have become important sources of fish for the poor elsewhere. In Sri Lanka for example, it is still prized [53] and whilst the species does not grow to a large size, it can be productive, with sizes that are accessible to poor consumers, at low cost. Fish for food security calculations [1] and [28] suggest that Solomon Islands may require between 6000 and 20,000 t from aquaculture by 2030. Such supply volumes, though, are unlikely to be achieved

by backyard pond farming of Mozambique tilapia. Coupled with a slow growth rate, Mozambique tilapia productivity is one of the lowest of all tilapia pheromone species [50]. With an optimistic annual productivity of 5 t/ha, typical, 100 m2 backyards ponds would produce, under optimal management, perhaps 50 kg of fish per year. Whilst significant for a household of five persons, more than 120,000 such ponds would be required to produce 6000 t of fish, which seems unlikely. Increasing urban populations will also restrict opportunities for homestead fish farming among many households, leading to a conclusion that a combination of homestead and more commercial enterprises would likely be required to supply future demand. The interactions and combination of these two types requires further research. Commercial farming is probably not feasible with Mozambique tilapia, as the species is unlikely to attract commercial investment, due to poor farming characteristics [42] and [52]. Introduction of new strains remains a possibility. Nile tilapia is being considered for introduction by government and would conceivably be a better candidate species.

, 2003 and Parris et al., 1999), as well as causing

the dysfunction of pre-synaptic muscarinic (M2) receptors, which enhances the release of acetylcholine (Nie et al., 2009). Chronic exposure to TNF has also been associated with the desensitisation of G-protein coupled receptors (Guo et al., 2005, Kang et al., 2006 and Osawa et al., 2007). The latter two mechanisms have been implicated in asthma pathogenesis. It is noteworthy that other mechanisms may also be involved, as the elevated secretion of TNF causes airway smooth cell contraction by activating different intracellular pathways, depending on pre- and post-transcriptional activity (Tirumurugaan et al., 2007 and Jude et al., 2011). In http://www.selleckchem.com/products/PD-0332991.html addition, we herein show that the TNF action is not dependent on the enhanced protein expression of TNFR1 or TNFR2, which suggests that the elevated concentration of this cytokine in response to in vivo HQ exposure may alter the ability of TNFRs to activate muscarinic receptors, the sensitivity or expression of muscarinic receptors, or subsequent signalling pathways. Mast cell degranulation is a hallmark of airway hyperresponsiveness. buy GSK2118436 Existing data on the mechanism by which TNF promotes mast cell degranulation and consequently, the release of a wide range of smooth muscle cell active mediators, including histamine, cytokines and leukotrienes, is controversial (Brzezińska-Blaszczyk et al., 2000,

Brzezińska-Blaszczyk et al., 2007 and Brzezińska-Blaszczyk and Pietrzak, 1997). Here we show that in vivo HQ exposure

causes CTMC and MMC degranulation that is dependent Calpain on TNF release, as the pharmacological inhibition of TNF synthesis reduced mast cell degranulation. Furthermore, TNF-induced mast cell degranulation of the HQ-induced tracheal hyperresponsiveness to MCh was further highlighted by the fact that pre-treatment with mast cell stabilizer partially reversed tracheal hyperresponsiveness. The data shown herein strongly suggest that the release of TNF by tracheal epithelium after low levels of HQ exposure triggers airway hyperresponsiveness in response to cholinergic stimulation. In addition, secreted TNF plays an important role in mast cell degranulation, with the subsequent release of chemical mediators that contribute to the maintenance of HQ-induced tracheal hyperresponsiveness. Together, the activation of these pathways may contribute to the development of airway diseases in subjects chronically exposed to HQ, such as smokers and inhabitants of polluted areas. The authors declare that there are no conflicts of interest. The authors thank Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) for financial support (grants no. 08/55382-7; 09/03964-5). Sandra H. P. Farsky and Wothan Tavares de Lima are fellows of the Conselho Nacional de Pesquisa e Tecnologia (CNPq). Simone M.

In conclusion, solid

stemmed wheat cultivars with relatively thin stems and large spikes could be used as parents for crossing in wheat breeding programs. In wheat, stem solidness is controlled by a single chromosome region on chromosome 3BL and two SSR markers, Xgwm247 and Xgwm340, could be used in wheat breeding for selecting solid stemmed individuals with lodging resistance. We thank Dr. Zhengqing Li and Dr. http://www.selleckchem.com/products/byl719.html Hongfei Lue, Institute of Botany, Chinese Academy of Sciences, for technical assistance. This study was supported by the National Basic Research Program of China (2011CB100302) and the Knowledge Innovation Program of CAS (KSCX2-EW-N-02). “
“Aphids are major agricultural pests which cause significant yield losses in crop plants each year by inflicting damage both through the direct effects of feeding and by vectoring harmful plant viruses [1] and [2]. Annual worldwide crop losses due to aphids are estimated at hundreds of millions of dollars [3] and [4]. click here Along with the application of nitrogen fertilizer and elevation

of atmospheric CO2 concentration, aphid infestation becomes more serious [5] and [6]. For many crops, insecticides provide a simple strategy for aphid control. However, the application of chemicals is not desirable because of the development of insecticide resistance and pollution of the environment [7]. Transgenic crops engineered for enhanced resistance to aphids could be an efficient alternative strategy. Some plant lectins, including Galanthus nivalis agglutinin (GNA) and Pinellia ternate agglutinin (PTA), are toxic to aphids in transgenic plants [8] and [9]. However, GNA caused adverse effects in the food chain of predatory ladybirds and the

parasitoid Aphidius ervi via aphids [10] and [11]; for example, when aphids were fed on GNA transgenic wheat, the GNA ingested by aphids and transported into the honeydew negatively affected the survival of parasitoid A. ervi consuming the honeydew [11], resulting in concerns relating Ribonucleotide reductase to biosafety issues for application of these lectin genes in agriculturally important crops for aphid control. Therefore, other safe and effective genes/genetic strategies for aphid control need to be found. Aphids are attacked by a wide range of predators and parasitoids, which strongly influence the growth and persistence of aphid colonies [1]. When attacked by a predator, aphids secrete cornicle droplets containing an alarm pheromone. The sesquiterpene EβF is the predominant and sometimes only component of most aphid alarm pheromones [12], [13] and [14]. EβF is detected by their nearby conspecifics and triggers various escape behavioral reactions, such as dropping off the plant, or flying or walking away [15].

Thus, non-synchronized neuronal activity within the first 80 ms

may also induce competition among local neuronal networks, which culminates in synchronization of inhibitory networks specific for the target. Amplitude of P1–N1 difference or alpha amplitude may be an indicator of the magnitude of synchronization. Increase in alpha activity either increase signal to noise ratio and allows processing of relevant information (contralateral hemisphere) or suppression of irrelevant information (ipsilateral hemisphere) ( Klimesch et al., 2007 and Klimesch, 2012). At the single cell level, estradiol increases, but progesterone decreases neuronal excitability (Majewska et al., 1986, Wong and Moss, 1992, Spencer et al., 2008 and Finocchi and Ferrari, 2011). this website As progesterone and its metabolites affects inhibitory, GABAergic synapses, fluctuations of endogenous progesterone during menstrual

cycle might affect synchronization of inhibitory networks. In the present study, we find that women with fast RTs show higher progesterone level compared to women with slow RTs. Further, progesterone correlates positively with alpha P1–N1 amplitude difference. Thus, assuming that alpha oscillations are inhibitory at the physiological level, an increase in progesterone may enhance inhibition via fine tuning rhythmic synchronization of neural networks leading to improvements in cognitive processing. Critically, the inhibition www.selleckchem.com/products/ABT-263.html model of alpha oscillations predicts that an increase in functional inhibition causes an increase in alpha amplitude. An increase in alpha amplitude, specifically in P1–N1 difference, may increase signal to noise ratio as well as tonic inhibition of networks processing irrelevant information (Klimesch et al., 2007). Both mechanisms improve cognitive processing. We summarize our results in a progesterone-dependent

alpha-inhibition model. This model combines the “inhibition model” (Klimesch, 2011) with the physiological consequences of progesterone on neuronal excitability Tyrosine-protein kinase BLK as well as on alpha oscillations. The progesterone-dependent alpha-inhibition model predicts in our cued spatial attention paradigm that an increase in progesterone is associated with (1) tonic mutual inhibition of ipsilateral cerebral hemispheres illustrated by a larger alpha P1–N1 amplitude difference in the ipsilateral hemisphere and (2) increase in signal to noise ratio in the contralateral hemisphere via enhancing GABAergic synaptic transmission visualized by larger alpha P1–N1 amplitude difference in women high in performance compared to women low in performance. Cerebral hemispheres are mutual inhibitory (Innocenti, 2009 and Bocci et al., 2014). Accordingly, in top down controlled attention tasks, neural equivalent of expectancy of a target may include a cue-induced increase in excitability in the contralateral, but an increase in inhibition in ipsilateral hemisphere.

Advantages of this platform include the application of versatile cell assays to quantitative (residual) munc13-4 function, and to rank severity of FHL3 mutations. It also offers the possibility to test small molecular weight compounds for their ability to restore secretory lysosome degranulation in FHL3. Antibodies were obtained from the indicated sources: p80 mouse hybridoma 5G10 (J. Bonifacino, NIH Bethesda), mouse anti serotonin (DAKO), mouse anti rat CD63 (BD Biosciences), mouse IgE anti DNP clone SPE-7 and corresponding

antigen Selleck Target Selective Inhibitor Library HSA-DNP (Sigma), mouse anti GFP (Roche), conjugated secondary antibodies (Jackson Immuno Research Laboratories). The rabbit antibody against munc13-4 has been described (Neeft et al., 2005). Following plasmids were generously provided by indicated

colleagues: peYFP-N1-Munc13-4 Forskolin solubility dmso cDNA (V.Gerke, ZMBE Münster), pLNT-SFFV-WPRE-Gateway (G. Griffiths, CIMR Cambridge), lentiviral helper plasmids psPAX2 and pMD2.G (A. Mertens UMC Utrecht). cDNAs encoding human munc13-4 and munc13-4-Δ608-611 were generated previously in this lab (Neeft et al., 2005). The RBL-2H3 cell line was generously provided by Ronit Sagi Eisenberg (Tel Aviv University) and cloned by limited dilution to obtain clones in which β-hexosaminidase secretion could be stimulated to yield at least 30% release. The cells were cultured in DMEM containing 1 mg ml−1 glucose, 10% heat-inactivated FCS (Bodinco), 100 U ml−1 penicillin, 100 μg ml−1 streptomycin, 2 mM l-glutamine, 50 nM 2-mercaptoethanol and passaged 3 times a week 1/20. Degranulation of RBL-2H3 cells is influenced by FCS and care was taken Immune system to obtain a batch that did not affect degranulation. HEK293T were cultured in DMEM (Invitrogen) 5 mg ml−1 glucose, 10% heat-inactivated fetal calf serum (Sigma), 100 U ml−1

penicillin, 100 μg ml−1 streptomycin and 2 mM l-glutamine. YFP-tagged munc13-4 cDNAs were extended with attB sites for cloning in pDONr201 (Invitrogen). After amplification inserts were transferred to the lentiviral plasmid pLNT–SFFV–WPRE–Gateway (Demaison et al., 2002) using LR Clonase II (Invitrogen). This lentiviral plasmid was developed to induce gene expression in hematopoietic cells using a spleen focus forming virus (SFFV) promoter, Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), central polypurine tract (cPPT) and appended with a gateway cloning cassette between the long terminal repeats (LTR). Primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTGAGCAAGGGCGAGGAGCTG (f), GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACGGTGCCGGCCGCAAGGC (r) were used for YFP on the N-terminus, and GGGGACAAGTTTGTACAAAAAAGCA GGC TTCATGGCGA CACTCCTCTCCCATCC (f), and GGGGACCACTTTGTACAAG AAAGCTGGGTCTTACTTGTACAGCTCGTCCATGC for YFP at the C-terminus. All constructs obtained through PCR were verified by sequencing. VSV-G pseudotyped lentivirus was prepared in low passage number HEK293T cells.

, 2006, Blank et al., 2008 and Maximov, 2011). Since the end of the 1980s several new species have been observed for the first time in the southern

part of the Baltic Sea, like Gammarus tigrinus Sexton, 1939 and Palaemon elegans Rathke, 1837 ( Gruszka, 2002, Janas et al., 2004a and Wawrzyniak-Wydrowska Topoisomerase inhibitor and Gruszka, 2005). The invasion of these two species and the retreat of native species in the coastal water bodies of the southern Baltic has been documented in gammarids ( Jażdżewski et al., 2004, Szaniawska et al., 2005 and Surowiec and Dobrzycka-Krahel, 2008) and palaemonids ( Grabowski 2006). The areas most likely to be colonised by new species are coastal lagoons and river mouths, where the broad

diversity of habitats and low salinity allow the co-existence of species of both freshwater and marine origin (Paavola et al., click here 2005 and Zaiko et al., 2007). One such area is Puck Bay, where eleven non-indigenous benthic species have settled. The studies carried out so far on the benthic communities of Puck Bay, dealing with species composition, density and biomass, have covered solely the non-indigenous species already present in these waters for several decades (e.g. Legeżyńska and Wiktor, 1981, Wenne and Wiktor, 1982 and Kotwicki et al., 1993). An exception is the paper by Kotwicki (1997), which supplies information on the density and biomass of Marenzelleria spp. Species of benthic fauna new to this area have usually been treated in separate articles ( Szaniawska et al., 2003, Janas et

al., 2004a and Janas and Wysocki, 2005), or at most they have been compared to other species from the same family (e.g. Jażdżewski et al., 2005, Spicer and Janas, 2006, Szaniawska et al., 2005, Grabowski, 2006 and Packalén et al., 2008). There are no papers, however, on the present-day occurrence of alien species forming benthic communities with other species, or on their proportions in the abundance of the entire macrozoobenthos. Such data are also scarce with respect to the whole Baltic Sea ( Ezhova et al., 2005 and Daunys and Zettler, 2006). Moreover, only fragmentary data are available on the preferred habitats of non-indigenous species and on the relationships between native and non-native species ( Zaiko et al. 2007). The objective also of this research was therefore to seek answers to the following questions: 1. What is the species composition, distribution and percentage share of non-indigenous species in the total number, abundance and biomass of benthic species in Puck Bay? Alien species are considered to be one of the most serious threats to coastal ecosystems (Gray 1997). Information on distribution, abundance, biomass and habitat preferences are of crucial importance in developing permanent monitoring programmes for alien species or designing a suitable mechanism for managing coastal ecosystems.

, 1996 and Schnakers et al., 2009b). The introduction of familiar voices aims at

increasing the bottom-up stimulus strength by adding emotional valence, which should make it easier to attend to the presented stimuli and will provide us with important information regarding the processing of emotional see more and self-relevant information in the absence of an explicit cognitive demand. We will focus on on-going oscillatory activity that is not necessarily exactly time-locked to the presentation of the stimulus, like event-related potentials. In fact, time–frequency analysis, quantifying evoked as well as induced brain activity, has been shown to be more sensitive than mere evoked responses which are more prone to temporal dispersion (Mouraux and Iannetti, 2008). Furthermore, concerning the intended clinical application in DOC patients in the future, it is important to consider that many DOC patients have prevailing background activity in the delta range that can interfere substantially with event-related potentials (Kotchoubey et al., 2005, Neumann and Kotchoubey, 2004 and Sabri and Campbell, 2002). Consequently, we believe that using time-frequency analysis together with a modified own name

paradigm using emotionally Cabozantinib cost and personally salient stimuli will be a more sensitive measure in identifying cognitive, and in future clinical applications, conscious processing. The main findings of ANOVA CONDITION (target vs. non-target; both spoken in a familiar voice)×ELECTRODES (Fz vs. Cz vs. Pz)×TIME (t1 vs. t2 vs. t3 vs. t4; t1=0–200 ms, t2 =200–400 ms, t3=400–600 and t4=600–800 ms post-stimulus),) showed that alpha desynchronization was higher for the target than for non-targets (F1/13=5.98, p<.05) (cf. Fig. 2 and Fig. 3). Additionally, main effects for ELECTRODES Etofibrate (F2/26=5.46, p<.05) and TIME (F3/39=8.05, p<.001) were revealed. Post hoc tests revealed that t3 and t4 significantly differed from t1 (t(13)=−3.88, p<.05; t(13)=−3.18, p<.05) while t3 differed from t2 (t(13)=−3.55, p<.05). Furthermore,

alpha ERD was higher on the electrode Pz compared to Cz (t(13)=2.86, p<.05) indicating generally larger desynchronization in the posterior part of the scalp and in particular in the last two time windows. The difference between the two conditions is also embedded in the interactions CONDITION×ELECTRODES (F2/26=5.27, p<.05) and CONDITION×TIME (F3/39=11.44, p<.001). Post-hoc tests on the first interaction revealed that target stimuli evoke stronger alpha ERD compared to non-targets mainly over Pz (t(13)=2.51, p=0.013) while post-hoc testing of the latter indicated that alpha ERD was stronger in response to targets as compared to non-targets only in the later time windows (t3: t(13)=−2.47, p<.05; t4: t(13)=−4.32, p<0.001).

This article discusses economic assessments of PET and PET/computed tomography reported until mid-July 2014. Forty-seven studies on cancer and noncancer indications were identified but, because of the widely varying scope of the analyses, a substantial amount of work remains to be done. “
“Robert M. Cohen The initial preclinical phase

of Alzheimer disease (AD), which has no symptoms, is followed by a phase whereby cognitive impairment, but no functional impairment is present (mild cognitive impairment), after which comes the third phase EPZ015666 mouse of dementia. Diagnosis of AD has primarily been one of exclusion of all other causes of reversible and irreversible dementia. Overlapping clinical presentations of diseases causing neurodegeneration, however, create challenges for accurate diagnosis. Algorithms are provided for the most current guidelines. Use of clinical magnetic resonance and PET imaging modalities increase the specificity of diagnosis, and several new promising INK 128 experimental approaches are being developed. Hannah Lockau, Frank Jessen, Andreas Fellgiebel, and Alexander Drzezga Magnetic resonance (MR) imaging is playing an increasingly pivotal role in the clinical management of dementia, including Alzheimer disease (AD). In addition to established MR imaging procedures, the

introduction of advanced instrumentation such as 7-T MR imaging, as well as novel MR imaging sequences such as arterial spin labeling, MR spectroscopy, diffusion tensor imaging, and resting-state functional MR imaging, may open new pathways toward improved diagnosis of AD even in

early stages of disease such as mild cognitive impairment (MCI). This article describes the typical findings of established and new MR imaging procedures in healthy aging, MCI, and AD. Vladimir Kepe PET with “β-amyloid–specific” molecular imaging probes is proposed for the measurement of brain β-amyloid protein amyloidosis in the new guidelines for diagnosis of Alzheimer disease (AD) at different levels of disease progression. This article discusses limitations of this proposed use pointing to unresolved issues and inconsistencies between PET scan results and correlation with other biomarkers, and with postmortem histopathological studies. These unresolved Methane monooxygenase issues do not warrant the conclusion that PET imaging with “β-amyloid–specific” molecular imaging probes can be used as a biomarker in AD or in the various stages of disease progression. Michael Kleinman and Samuel Frank Parkinson disease (PD) is the second most common neurodegenerative disease, typically affecting elderly individuals and with a disproportionate male prevalence. Some genetic predispositions and environmental exposures are proposed risk factors for the development of PD. Cigarette smoking, caffeine intake, and increased serum uric acid have the strongest data supporting a reduced risk of PD.

The spatial dynamics of fishery resources (notably the key sea cucumber and spiny lobster stocks) and of the fishing fleet must be measured and modeled to assess the applicability of spatially-explicit management measures (TURFs, seasonal closures, spatial gear restrictions,

etc.) in order to reduce overexploitation risks. Consider, for Sunitinib supplier example, the case of broadcast spawners, such as sea cucumbers, which – as for many sedentary species – require high density concentrations in order to reproduce successfully. Such high-density patches are the first to be targeted by fishers in a fishery regulated by catch or effort limits [37], making management measures such as total allowable catch (TAC) inappropriate in the fisheries for these species. In this case, a spatially explicit management tool, such as seasonal closures, could be more effective than a TAC (e.g., to protect sea cucumber juveniles). On the other hand, caution is needed with spatial measures such as no-take zones since changes in the distribution of fishing effort could lead to overfishing

of the stocks located outside the zone [37] and [52]—it is thus necessary to evaluate the impact of zoning on fleet distribution. Current monitoring Obeticholic Acid purchase programs must be evaluated, adapted, and coordinated with the goal of producing needed spatial planning information, integrating the collection of socioeconomic data on a regular and strategic basis. According to Day [11], the establishment of a robust monitoring system to evaluate the effectiveness of marine spatial management plans requires a major institutional reorientation at the policy

level. In the case of Galapagos, it will require a major adaptation of the GMRMP, including as a priority the allocation of suitably long-term governmental Vasopressin Receptor funding to ensure the continuity and efficiency of the monitoring programs. Also important are efforts to better utilize existing data (biophysical, socioeconomic and fishery data) in order to extract the maximum value from them [44]. Furthermore, the above-noted monitoring capability of VMS together with the recent implementation of an Automatic Identification System (AIS) for the entire local fishing fleet, provides an unique opportunity to better understand the spatial behaviour of fishers, and thereby to predict how this behaviour interacts with spatial population processes to determine the character of exploited meta-populations; and to understand the implications of policy options ranging from no-take zones to TURFs [43]. Such an evaluation of the GMR will facilitate adaptation of the marine zoning scheme, taking into consideration the scientific information available, the local fishery knowledge and the lessons learned as outlined above.

40 Based on the proven superiority of split-dose bowel regimens over single-dose regimens, professional guidelines41 and 42 Doxorubicin now recommend use of split-dose

preparation. Morning consumption of laxative as part of a split-dose regimen creates 2 concerns. First, patients may be resistant to waking early to complete the laxative. Despite this pragmatic consideration, patients do generally accept and comply with split dosing. Unger and colleagues43 reported 78% compliance with a split dose in patients receiving early morning colonoscopy. Several studies44 and 45 have also shown that patients better tolerate split-dosing preparations. The second concern pertains to the safety of split-dosing administration. Specifically, ingestion of the second dose of a bowel laxative within 2 to 6 hours of colonoscopy might increase the risk for aspiration during sedation (moderate, deep, or general anesthesia). Updated guidelines from the American Society of Anesthesiologists46 state that patients need to abstain from clear liquids for only 2 hours before receiving sedation. Nonetheless, some anesthesiologists question the clinical and safety equivalency of PEG solutions to other clear

liquids. In addressing these concerns, despite widespread use of PEG solutions for almost 30 years in millions of patients, there are only rare (<12), isolated reports of fatal, aspiration-induced chemical pneumonitis after administration of a PEG solution (most commonly occurring with nasogastric administration in adults DNA Damage inhibitor or children with altered mental status). Dynein Furthermore, a 2010 study47 showed no difference in residual gastric volume in patients taking a split-dose bowel

preparation (19.7 mL) versus a single-dose evening preparation (20.2 mL). Therefore, based on their proven superiority, split-dose bowel regimens should be recommended for most patients with IBD undergoing surveillance whose disease is in remission or well controlled. Caution is advised in patients with partial bowel obstruction, gastroparesis, or known delayed intestinal motility, because these patients are at increased risk for gastric retention and aspiration. In these instances, a 6-hour window is recommended between completion of the laxative ingestion and initiation of sedation. Several laxative formulations are available for preparation before colonoscopy. Randomized controlled trials comparing these agents are limited, and none has proven superiority. However, for all available agents, a split-dose regimen generally is preferred to single-dose regimens. Laxative options may be subsumed under 2 broad categories: PEG solutions and low-volume, hyperosmolar solutions (see Table 2). Several PEG solutions are available, including full-volume (4 L) balanced, isosmotic formulations (standard or sulfate-free) and a reduced volume (3 L) formulation, which contains ascorbate.