e In vitro kinase assay of IKK was done as described in “Materials and methods”. The IC50 values were approximately 57.6 μM. Values were expressed as means ± SD (n = 3) Kinsenoside inhibited NFATc1 expression RAW 264.7 cells were incubated with RANKL in the presence

or absence of kinsenoside for 2 h. Treatment with RANKL for 24 h raised the protein expression levels of NFATc1 by GSK2245840 cost Western blot analysis (Fig. 5b; p < 0.05). The expression level of NFATc1 in the RANKL group was 3.5 times greater than that in control group. Pretreatment with kinsenoside led to a 40 % (25 μM; p < 0.05) and 60 % (50 μM; p < 0.05) decrease in NFATc1 expression (Fig. 5b). Effects of kinsenoside on cytoplasmic phosphorylation levels of p-IκBα, p-p65, and p-IKKα/β in RANKL-stimulated RAW 264.7 cells RAW 264.7 cells were incubated with RANKL in the presence or absence of kinsenoside for 2 h. Treatment

with RANKL for 1 h increased the cytoplasmic phosphorylation click here levels of p-IκBα, p-p65, and p-IKKα/β, but not IκBα, IKKα, and IKKβ, by Western blot analysis (Fig. 5c and d). The phosphorylation levels of p-IκBα and p-p65 in the RANKL group were 182 % Y-27632 cell line (p < 0.01) and 182 % (p < 0.05), respectively, both of which were greater than those in the control group. Kinsenoside treatment did not affect the level of IκBα. Kinsenoside treatment led to 27 % (25 μM; p < 0.05) and 39 % (50 μM; p < 0.05) decreases in p-IκBα level and 16 % (10 μM; p < 0.05), 32 % (25 μM; p < 0.05), and 39 % (50 μM; p < 0.05) decrease in p-p65 level (Fig. 5c). The levels of p-IKKα/β in the RANKL group were 145 % (p < 0.05) greater than that in the control group. Kinsenoside treatment did not affect the levels of IKKα, IKKβ, and p-IKKα/β (Fig. 5d). Kinsenoside inhibited

IKK activity To determine whether kinsenoside interacts with IKK directly, this study examines the effects of kinsenoside on IKK enzymatic activity. The culture treatment of RAW 264.7 cells with 50 ng/ml RANKL for 1 h effectively increased IKK activity. Kinsenoside treatment (10–200 μM) for 2 h inhibited IKK activity in a concentration-dependent manner. The IC50 value was approximately 57.6 μM Ceramide glucosyltransferase (Fig. 5e). Kinsenoside did not affect the mRNA expression of RANK and TRAF6 The fragments shown in Fig. 6a reflect the pooled data for three samples. The BMs were incubated with M-CSF (20 ng/ml) for 3 days to induce the production of osteoclast precursor. Osteoclast precursors incubated with kinsenoside for 120 min were then treated with M-CSF (20 ng/ml) and RANKL (50 ng/ml) for 1 day in the presence or absence of kinsenoside. As Fig. 6a shows, RT-PCR amplified fragments of RANK and TRAF6. The RANK/GAPDH and TRAF6/GAPDH ratios in the RANKL group were 170 % (p < 0.05) and 220 % (p < 0.05), respectively, both of which are greater than those in the control group. Kinsenoside treatment (10–50 μM) did not affect the ratios of RANK/GAPDH and TRAF6/GAPDH (Fig. 6a). Fig.

Recombination was confirmed by PCR. The transduction of the mutation into Rm1021 strain yielded R7.16. Analysis of ohr regulation by OhrR ohr::lacZ region was released from pD5455 using XbaI and SphI and introduced between the corresponding sites Histone Methyltransferase inhibitor of pBBR1-MCS2 vector (replicative in S. meliloti), yielding pE1541.

This plasmid was introduced by triparental mating into the wild type strain and ohrR mutant (R6.48) and β-galactosidase activities were assayed in both strains. Complementation plasmids The open reading frames of ohr and ohrR were amplified using the primers (GATCGGCCTCGACCCATACG) and (CCTCGTCTAGATGTCATTGTCG) for ohr and (CGTCGATAAAGAAGCCTGTG) and (CAGCGCGTGTGGCGGCG) for ohrR. The amplicons were cloned into pGEMTeasy, see more released by EcoRI cleavage

and introduced into the same site in pBBR1-MCS2 vector. The correct orientation allowing the expression of these genes under the control of lac promoter was selected. The corresponding plasmids pBBohr and pBBohrR were introduced into Rm1021 strain and the various mutants by triparental mating. Purification of OhrR protein The ohrR open reading frame was amplified by PCR using the primers (CGACAATGACATATGACGAGG) and (AGCTCTCGAGTCGACTACCG) and cloned in pGEMT. The insert was released as an NdeI-XhoI DNA fragment and introduced into the expression vector pET22b+ (Novagen) giving pETohrR where the ohrR ORF is fused to a 6his-tag at its 3′ extremity. BL21(DE3) cells harbouring pETohrR were cultured in LB medium at 37°C until OD570 nm of 0.8; isopropyl-β-D-galactopyranoside was then added to a final concentration of 1 mM. The culture was grown for an AR-13324 clinical trial additional 4 h, and cells were harvested by centrifugation (5,000 × g, 10 min, 4°C). Bacterial cells were washed in TE (10 mM Tris pH 6.8, 1

mM EDTA) and resuspended in the same buffer with 1 mM phenylmethylsulfonyl ifenprodil fluoride. Cells were disrupted by three passages through a French press (1,200 PSI), and cell debris were removed by centrifugation at 4°C, 12,000 × g for 30 min. Proteins were loaded on a heparin column (GE heath care), followed by a wash (10 column volumes) with buffer A (25 mM Tris-HCl pH8, 25 mM NaCl, 2 mM EDTA, 1 mM DTT). Elution was performed with the same buffer containing 0.5 M NaCl. The eluted fractions were analysed by SDS-PAGE, and those containing OhrR were pooled and dialysed against buffer A. Gel mobility shift The intergenic region between ohr and ohrR was amplified by PCR using the primers (ATGATGTCATTGTCGCAAATTC) and (CATGACAGTCTCCTTCCTTGTG) as a 113 bp DNA fragment. Complementary oligonucleotides (Figure 4) were also used in gel mobility assay; they were annealed in 50 mM Tris-HCl pH8, 0.25 M NaCl, 1 mM EDTA. DNA probes (20 pmoles) were incubated with OhrR protein (0 to 100 pmoles) in 20 μl binding buffer (20 mM Tris-HCl (pH 8.0), 50 mM KCl, 1 mM EDTA, 50 μM bovine serum albumin) at room temperature for 10 min. Binding mixture was run on 6% polyacrylamide gel in Tris-borate buffer.

5× Tris-boric acid-EDTA TBE buffer at 14°C by using CHEF MAPPER (BioRad). The runtime was 21.30 h at 6 V/cm, with initial and final switch times of 2.16 and 54.17 s, respectively. The gel was stained with ethidium bromide (1 μg/mL), observed on the Gel Doc 2000 system (BioRad), and analyzed with the BioNumerics fingerprinting software (Applied Maths, St-Martens-Latem, Belgium). Cluster analysis of the Dice similarity indices based on the unweighted pair group method using arithmetic averages (UPGMA) was done to generate a dendrogram describing the relationship among PFGE profiles. Isolates were considered to be related if their Dice similarity index was > 85% according to Tenover’s

criteria (≤ six bans of difference) [31]. Statistical analysis For APEC, NMEC and septicemic/UPEC populations, Fisher’s exact test was used to test the selleck inhibitor null hypothesis of equal gene prevalence rates

across the three populations studied. For each comparison, a P value of < 0.05 was considered to denote significant differences. AUY-922 concentration Acknowledgements We thank Monserrat Lamela for skillful technical assistance. This work was supported by grants from European Commission (FAIR6-CT-4093; PEN project FOOD-CT-2006-36256), the Fondo de Investigación Sanitaria from the Ministerio de Sanidad y Consumo de España (grants FIS G03-025-COLIRED-O157, PI052023, PI051481 and REIPI RD06/0008/1018), Ministerio de Educación y Ciencia de España (AGL-2008-02129) and the Xunta de Galicia (grants PGIDIT05BTF26101P, PGIDIT065TAL26101P, 07MRU036261PR, 08TAL017261PR). A. Mora

acknowledges the Ramón y Cajal programme from the Ministerio de Educación y Ciencia de España. References 1. Russo TA, Johnson JR: proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli : ExPEC. J Infect Dis 2000, 181:1753–1754.CrossRefPubMed 2. Ewers C, Li G, Wilking H, Kiessling S, Alt K, Antáo EM, Laturnus C, Diehl I, Glodde S, Homeier T, Böhnke U, Steinrück H, Philipp HC, Wieler LH: Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli : how closely Phosphoglycerate kinase related are they? Int J Med selleck kinase inhibitor Microbiol 2007, 297:163–176.CrossRefPubMed 3. Johnson JR, Russo TA: Molecular epidemiology of extraintestinal pathogenic (uropathogenic) Escherichia coli. Int J Med Microbiol 2005, 295:383–404.CrossRefPubMed 4. Blanco JE, Blanco M, Mora A, Jansen WH, García V, Vázquez ML, Blanco J: Serotypes of Escherichia coli isolated from septicaemic chickens in Galicia (Northwest Spain). Vet Microbiol 1998, 61:229–235.CrossRefPubMed 5. Dho-Moulin M, Fairbrother JM: Avian pathogenic Escherichia coli (APEC). Vet Res 1999, 30:299–316.PubMed 6. Wiles TJ, Kulesus RR, Mulvey MA: Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol 2008, 85:11–19.CrossRefPubMed 7.

(PDF 146 KB) Additional file 10: Figure S7: Schematic diagram of the Rad3 helicase family in G. lamblia. The representation is to scale. Inset: sequence LOGO view of the consensus amino acids. The height of each amino acid represents the degree of conservation. Colors indicate properties of the amino acids, as follows: green (polar), blue (basic), red (acidic)

and black (hydrophobic). (PDF 148 KB) Additional file 11: Figure S8: Western blot of trophozoites grown under proliferating conditions and after induction to encyst. Total protein extracts from trophozoites grown under normal proliferating conditions (Normal) or after 16hs induction in encystation medium (Encyst) were separated using a 10% SDS-polyacrylamide gel and find more transferred to a PVDF membrane. The membrane was incubated with a monoclonal antibody against CWP2. The iqual loading of the samples is shown in the figure at the right with a Ponceau S staining. The numbers indicate the molecular weight of protein standards in kDa. (PDF 97 KB) Additional file 12: Figure S9: SAGE (Serial Analysis of Gene Expression) data. The Savolitinib clinical trial graph represents the sense tag

percentage from Giardia trophozoites (white bar) and four different encystation times (4, 12, 21 and 42 hours; grayscale bars). Under each ORF it is indicated if these ORFs were up-regulated (green up arrow), down-regulated (red down arrow) or remained unmodified (equal sign). A line graph is also provided for a better identification of the expression pattern. The colored boxes

represent our RT-qPCR results (with the same color code), divided into families. The asterisk under each box stands for a correlation between the SAGE and the RT-qPCR data. (PDF 236 KB) Additional file 13: Figure S10: Western blot during antigenic variation induction. Trophozoites were incubated for the indicated times with a 1:10.000 dilution of mAb 5C1directed against VSP-1267, mAb 7D2 against Cyst Wall Protein 2 or without antibody (Control). Total protein was electrophoresed, transferred to a PVDF membrane and incubated with a mAb against the VSP-1267. The molecular Celecoxib weights of standards are indicated in kDa. (PDF 71 KB) Additional file 14: Table S4: Accession numbers. The table indicates a complete list of proteins cited in the manuscript, the organism it is derived and the NCBI Reference Sequence Number. (XLSX 10 KB) Angiogenesis inhibitor References 1. Abdelhaleem M: Helicases: an overview. Methods Mol Biol 2010, 587:1–12.PubMedCrossRef 2. Linder P, Jankowsky E: From unwinding to clamping – the DEAD box RNA helicase family. Nat Rev Mol Cell Biol 2011, 12:505–516.PubMedCrossRef 3. Singleton MR, Dillingham MS, Wigley DB: Structure and mechanism of helicases and nucleic acid translocases. Annu Rev Biochem 2007, 76:23–50.PubMedCrossRef 4. Kainov DE, Tuma R, Mancini EJ: Hexameric molecular motors: P4 packaging ATPase unravels the mechanism. Cell Mol Life Sci 2006, 63:1095–1105.PubMedCrossRef 5.

1993; Karp 1996; Schultz and Zelenzy 1998; Milfont 2003; Poortinga et al. 2004). Several variables that are specific to sharing resources and supporting policy where also included: climate change risk perception, perceived social capital, self-reported political participation, and a Commons Dilemma variable that measures how much an individual trusts the citizens of their own city or another city to share resources in

a period scarcity. Finally, common demographic variables were included and hypothesized to follow previously determined patterns (Stern et al. 1993): Younger Democratic women would be more likely to vote for a PAIRS policy. Contextual variables included home ownership and years of local residence. Individuals with a longer history of ownership within the community were expected Crenolanib to have a greater interest in the long-term success and sustainable growth of the community, and thus support reciprocal sharing initiatives to a greater extent than a transient rental tenant. Results PAIRS PF-02341066 ic50 metric analysis The PAIRS metric can be applied to specific cities to highlight areas of mutual BAY 73-4506 in vivo sustainability benefits. To establish a baseline and evaluate the effectiveness of

the PAIRS metric, a pairwise analysis was conducted with 10 southern California cities listed in Table 2. These cities were

initially selected due to the amount of publically available data on local resources and sustainability practices. However, insufficient data existed in the public domain to complete the PAIRS metric analysis. Proxy data and regional averages were applied to fill data gaps. Due to the extent of proxy data utilized, the resulting conclusions cannot be supported for these specific city combinations, but they do represent a range of archetypal cities common to urban areas in the United States and around the world. FAD The distribution of existing sustainability for each city varied across all five sectors as shown in Fig. 1. The cities chosen varied widely in terms of scale, primary industry, and interest in sustainability. Natural factors such as propensity for drought, available natural resources, open land space, and distance from neighboring cities played a distinct role in the potential for synergistic partnerships. As many of these features can differ between cities of the same scale and industry, these 10 cities do not capture every possible scenario, but are useful in demonstrating the application of the PAIRS metric.

These mechanisms Y27632 are modulated by the activation of several signaling pathways, such as PI3K, ERK/MAPK and c-Src GSK3235025 molecular weight tyrosine kinase [41], which are known downstream signals of adipokines [43]. In fact, many adipokines (e.g. IGF-1, osteopontin, leptin, adiponectin, VEGF, thrombospondin, interleukin-8 and IL-6) have been shown to modulate different steps of cell motile behavior [44–56]. The repetitive and coordinated cycling of these processes results in productive locomotion of the cell. Several key pathways and molecules involved in this process can be induced by factors secreted by adipose

tissue, hence supporting the increased motility we found in stimulated prostate cancer cells. Nevertheless, besides the influence of extrinsic factors, migratory tumor cells also present autocrine growth factor signaling systems [57]. We disclose any potential bias from inadvertent selection using manual cell tracking analysis, urging careful interpretation of motility findings. Further studies find more using migration assays to extend and confirm

our results are warranted. Adipose tissue is a heterogeneous organ that consists of multiple cell types: adipocyte fraction, which contains lipid-loaded adipocytes, and stromal-vascular fraction, which includes preadipocytes, endothelial cells, fibroblasts, stem cells, macrophages and other immune cells [58]. The fractions of adipose tissue differ in that while explants reflect an organotypic cell culture system of whole adipose tissue, the major characteristic of stromal-vascular fraction culture is the depletion of adipocytes and absence of extracellular

matrix. In order to investigate which fraction influenced tumor cells, we cultured paired explants and stromal-vascular fraction cells. To allow comparison between depots and adipose tissue fractions, the cell count was adjusted per gram of adipose tissue. Interestingly, our findings showed that media from explants and PP adipose tissue depot presented the higher gelatinolytic activity per Carbohydrate gram of adipose tissue, compared with SVF cultures- and VIS adipose tissue-derived media. Although the amount of MMP9 has been described to be higher in stromal-vascular fraction of adipose tissue compared with adipocytes [22], the latter have greater plasticity to increase MMPs expression when interacting with other cells in adipose tissue [22, 59]. The increased activity of metalloproteinases in CM from adipose tissue explants in culture compared with SVF, likely reflect the additive effect or interaction between cells of the stromal-vascular fraction plus adipocytes. We found that MMP2 activity was increased in PP versus VIS adipose tissue supernatants.

Genome Biol 2009, 10:R51.click here PubMedCrossRef 42. Mathee K, Narasimhan G,

Valdes C, Qiu X, Matewish JM, Koehrsen M, Rokas A, Yandava CN, Engels R, Zeng E, Olavarietta R, Doud M, Smith RS, Montgomery P, White JR, Godfrey PA, Kodira C, Birren B, Galagan JE, Lory S: Dynamics of Pseudomonas aeruginosa genome evolution. Proc Natl Acad Sci USA 2008, 105:3100–3105.PubMedCrossRef 43. Moynihan JA, Morrissey JP, Coppoolse ER, Stiekema WJ, O’Gara F, Boyd EF: Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens . Appl Environ Microbiol 2009, 75:2122–2131.PubMedCrossRef 44. Roy PH, Tetu SG, Larouche A, Elbourne L, Tremblay S, Ren Q, Dodson R, Harkins D, Shay R, Watkins K, Mahamoud Y, Paulsen IT: Complete genome sequence of the multiresistant taxonomic outlier Pseudomonas aeruginosa PA14. LGK974 PLoS One 2010, 5:e8842.PubMedCrossRef 45. Sarkar S, Guttman D: Evolution of the core genome of Pseudomonas syringae , a highly clonal, endemic plant pathogen. App Env Microbiol 2004, 70:1999–2012.CrossRef 46. Rojo F, Dinamarca A: Catabolite repression and physiological control. In Pseudomonas: virulence and gene regulation. Volume 2. Edited by: Ramos JL. Kluwer Academic/Plenum Publishers; Selleckchem PXD101 2004:365–387. 47.

Schultz JE, Matin A: Molecular and functional characterization of a carbon starvation gene of Escherichia coli . J Mol Biol 1991, 218:129–140.PubMedCrossRef 48. Schultz JE, Latter GI, Matin A: Differential regulation by cyclic AMP of starvation protein synthesis in Escherichia coli . J Bacteriol 1988, 170:3903–3909.PubMed 49. Azam TA, Ishihama A: Twelve species of nucleoid-associated protein from Escherichia coli . Sequence recognition specificity and DNA binding affininty. J Biol Chem 1999, 274:33105–33113.PubMedCrossRef 50. Cases

Racecadotril I, de Lorenzo V: The genomes of Pseudomonas encode a third HU protein. Micriobiology Comment 2002, 148:1243–1245. 51. Pérez-Martín J, de Lorenzo V: The σ 54 -dependent promoter Ps of the TOL plasmid of Pseudomonas putida requires HU for transcriptional activation in vivo by xylR . J Bacteriol 1995, 177:3758–3763.PubMed 52. Yuste L, Hervás AB, Canosa I, Tobes R, Nogales J, Pérez-Pérez MM, Santero E, Díaz E, Ramos JL, de Lorenzo V, Rojo F: Growth phase-dependent expression of the Pseudomonas putida KT2440 transcriptional machinery analysed with a genome-wide DNA microarray. Environ Microbiol 2006, 8:165–177.PubMedCrossRef 53. Valls M, Buckle M, de Lorenzo V: In vivo UV laser footprinting of the Pseudomonas putida σ 54 promoter reveals that integration host factor couples transcriptional activity to growth phase. J Biol Chem 2002, 277:2169–2175.PubMedCrossRef 54. Ward PG, de Roo G, O’Connor KE: Accumulation of polyhydroxyalkanoate from sytrene and phenylacetic acid by Pseudomonas putida CA-3. Appl Environ Microbiol 2005, 71:2046–2052.PubMedCrossRef 55.

05(CI 95% 0.85–1.29), as Figure 5. The test for heterogeneity was not statistically significant with p value 068, which indicates that the pooling of the data was valid. In the subgroup analysis there was no difference for overall survival among different clinical stages I, II and III, as demonstrated in Table 4. Figure 5 Local recurrence for all clinical stages in cervix cancer. Grade 3 or 4 Rectal, Bladder or Small Intestine complications Five trials evaluated www.selleckchem.com/products/gw3965.html rectal or bladder complications. For grade 3 or 4 rectal and bladder complication, there was no significant difference between

HDR and LDR, as demonstrated Barasertib in Table 4. Only 3 studies reported the small intestinal complications as one of its outcomes. No significant difference was observed between the treatment arms, considering grade 3 or 4 complication, as showed in Table 4. Discussion Approximately 11,070 women Selleck Ro 61-8048 are diagnosed with cervical

cancer annually in the US, resulting in 3,870 deaths [27]. This represents 0.13 percent of all cancer deaths in women. Despite this, and the promise of newly developed cervical carcinoma vaccines [28], cervical carcinoma is still the third largest cancer killer of women world-wide, causing 274,000 deaths in 2002 [29]. Cervix cancer is a curable cancer, but achieving the best results depends on well-organized and appropriately resourced cancer services. Brachytherapy is an integral part of the cervical carcinoma treatment armamentarium. It is a technically demanding and highly specialized method of radiotherapy delivery. Depending on the equipment used, the capital expenditures and staff costs may be high.

Fractionated HDR brachytherapy in the treatment of uterine cervix cancer has been increasing worldwide, including in the United States [2]. In developing countries such as Brazil, the advantages of outpatient treatment, potential cost savings, radiation protection, patient comfort, reduction of the need for general anesthesia, and less chance of applicators displacement make of this procedure an excellent treatment option [30]. Unfortunately, a well-designed prospective and randomized Phase-III trial with an adequate Exoribonuclease number of patients that would allow comparison of results between LDR and HDR brachytherapy in the treatment of cervix cancer has not yet been published. Thus, we have performed a meta-analysis to improve the statics precision of the outcomes in the clinical trials that compared these two techniques. Meta-analysis of randomized trials allows a more objective appraisal of the evidence, which may lead to the resolution of uncertainty and disagreement. It works as a valuable tool for studying rare and unintended effects of a treatment, by permitting synthesis of data and providing more stable estimates of effect. Our results analyzing five RCTs (2,065 patients) really confirm the use of HDR as an alternative to LDR for all stages of cervical carcinoma.

g. Sanchez et al. 2007), it has also been isolated from immunocompromised humans (Kuhls et al. 1997; Kredics et al. 2003). Its ability Selleck PRN1371 to grow at human body temperature should give caution to those who would wish to develop this species as a biocontrol agent. Apparently T. longibrachiatum is a clonal species. Kuhls et al. (1997) and Samuels et al. (1998) noted

that T. longibrachiatum and Hypocrea orientalis could not be distinguished on the basis of ITS sequences but for reasons of phenotype, they did not consider the two to represent a single species. The distinction was supported by MALDI-TOF MS by De Respinis et al. (2010) and by multilocus phylogenetic analysis and Druzhinina et al (2008) postulated that T. longibrachiatum and H. orientalis could have evolved in Stattic clinical trial parallel from a common species forming two sympatric AZD1390 mw species. However in the multilocus analysis of Druzhinina et al. (2012) H. orientalis and T. longibrachiatum clearly represent a species complex within which there are several well-supported internal lineages, some of which we recognize here as distinct sister species, viz. T. aethiopicum

and T. pinnatum, the latter derived from ascospores of a collection made in Sri Lanka but also isolated from soil in Vietnam. The single strain CBS 243.63, based on an ascospore culture from New Zealand, is a distinct phylogenetic lineage; however the culture appears to be degenerated and the collection from which it was made cannot be located. 12. Hypocrea novae-zelandiae Samuels & O. Petrini in Samuels

et al., Stud. Mycol. 41: 25 (1998; as ‘novaezelandiae’). Anamorph: Trichoderma sp. Ex-type culture: G.J.S. 81–265 = CBS 639.92 = ATCC 208856 Typical sequences: ITS DQ083019, tef1 X93969 This species was based originally on two collections old made in native Nothofagus forests of New Zealand (Samuels et al. 1998) and remains known only from New Zealand, where it is not uncommon. Hypocrea novae-zelandiae occupies a basal position in the Longibrachiatum Clade (Druzhinina et al. 2012). It forms a clade with the new species T. saturnisporopsis and the phylogenetic species G.J.S. 99–17. Within this clade there are two morphologically unequivocal groups: one with ellipsoidal to oblong, smooth conidia and known only from sexual spores (H. novae-zelandiae) and one apparently clonal group having ellipsoidal, grossly tuberculate conidia (Tr 175: USA: OR; S19: Sardinia; G.J.S. 99–17: Japan). The strains having warted conidia represent two phylogenetic species that are discussed below under T. saturnisporopsis. 13. Hypocrea orientalis Samuels & O. Petrini in Samuels et al., Stud. Mycol. 41: 30 (1998). Figures 3a–c and 12. Fig. 12 Hypocrea orientalis. a–c Pustules. d–f Conidiophores. g Phialides. arrows show intercalary phialides. h Conidia. i Part-ascospores; note the globose to subglobose shape. j, k Stromata. a–g from SNA. a, c, g from G.J.S.