MS, according to the National Cholesterol Program (NCEP) Adult Treatment Panel III (ATP III), can be defined as the presence of at least three of the following clinical criteria: waist circumference

>88 cm in women, HDL-C <50 mg/dl, blood pressure ≥130/85 mmHg, triglyceride >150 mg/dl and insulin resistance [3]. The prevalence of MS is high in the general population with approximately 34% of adults meeting the above-mentioned criteria and increases with age and body mass index (BMI). In fact, women over 60 years and overweight SB525334 or obese are much more likely to meet the MS criteria [4]. Consistently, post-menopausal women are often affected by MS and, interestingly, show the highest incidence of breast cancer in the female population [1]. Although many epidemiological studies link obesity and MS to the increased frequency of many cancer types, the molecular mechanisms underlying this increased risk are still poorly characterized. Visceral adipose tissue has multiple endocrine, metabolic and immunological functions and has been

shown to be central in the MS pathogenesis. MS is a pro-inflammatory, pro-coagulant state associated with insulin resistance [5, 6]. The increase in adipose tissue mass, which characterizes MS, can have both direct and secondary effects favouring tumorigenesis [6]. Obese patients often develop insulin resistance with various tissues showing low cell sensitivity to insulin activity. As a consequence, NVP-HSP990 a balancing mechanism stimulates insulin release resulting in a chronic compensatory hyperinsulinemia. By continuously stimulating insulin signalling in sensitive tissues, high levels of circulating insulin cause aberrantly increased mitogenic and antiapoptotic effects [7]. Although the obese state generates peripheral insulin resistance in many tissues, not all insulin signalling is impaired. In the diabetic liver, the gluconeogenic pathway becomes insulin resistant, and insulin-stimulated lipogenesis remains sensitive. Thus, in insulin-resistant patients, specific

tissues and signalling pathways Idoxuridine can remain insulin-sensitive and are exposed to higher than normal levels of insulin signalling. Initial experiments demonstrated that in human breast cancer cell lines insulin has been shown to promote DNA synthesis, suggesting a mitogenic effect [6]. When insulin concentrations are high, insulin — which is structurally similar to insulin-like growth factor 1 and 2 (IGF1 and IGF2) — acts also as a growth factor by binding the IGF-receptors (IGF1R and IGF2R) [8, 9]. Moreover, increased insulin signalling can induce overexpression of the receptors [9]. Consistently, in vitro and in vivo studies have shown insulin receptor overexpression in breast tissue.

The MST was created based on the categorical coefficient and a priority rule consisting of the highest number

of single-locus variants. Cilengitide The polymorphism index of individual or combined VNTRs was calculated using the Hunter-Gaston discriminatory index (HGDI) [23]. Results Identification of VNTRs for MLVA typing Among the 130 TRs tested, only five were polymorphic with different allele sizes, making them useful for discriminating among types. The five VNTRs selected are distributed around the genome from nucleotide positions 181200 to 298794 in the M. hominis PG21 reference strain (Table 1). The PCR products ranged in size from 153 to 290 bp in the M. hominis KPT-8602 order PG21 reference strain. All of the VNTRs were located in open reading frames (ORFs). Markers Mho-52, Mho-53 and Mho-116 were located in the rpoD gene encoding the RNA polymerase sigma factor RpoD, the pgsA gene encoding the CDP-diacylglycerol-glycerol-3-phosphate-3-phosphatidyl transferase and the oppA gene encoding the oligopeptide ABC transporter substrate-binding protein, respectively. The two other markers were located in ORFs encoding hypothetical proteins. The sizes of the unit repeats ranged from 3 bp to 42 bp.

Sequencing the PCR products of different sizes at each of the five loci from each of the 12 screening isolates confirmed the sizes and sequences of the individual VNTR loci. Table 1 Characteristics of the five VNTR markers Name Nucleotide positiona(bp) Locus (protein no. in the genome sequence) Repeat size (bp) Consensus sequence % identity between VNTRs HGDIb Mho-50 298627-298794 Hypothetical protein, predicted lipoprotein (MHO_2440) 42 TCAAGATTCTACAACCACAGGTGAAGATTCGACTGGACAATC 98 0.313 Mho-52 259317-259340 rpoD gene (MHO_2150) 3 GAT 82 0.203 Mho-53 246308-246325 pgsA gene (MHO_2070) 3 ATT 100 0.784 Mho-114 190335-190346 Hypothetical protein, predicted lipoprotein (MHO_1590) 6 TTGGCT Acetophenone 100 0.336 Mho-116 181200-181202 oppA gene (MHO_1510) 3 GAA 100

0.020 aPosition (5’ end) on the M. hominis PG21 genome sequence. bHGDI, Hunter Gaston Diversity Index. The stability of the five polymorphic markers in five strains was examined after 10 serial passages in Hayflick modified broth medium supplemented with arginine. The analysis of the five strains resulted in identical MLVA profiles for all markers. The use of fluorescently labelled primers in two multiplex PCRs (Mho-50, Mho-52 and Mho-53 for PCR T1 and Mho-114 and Mho-116 for the PCR T2), and capillary electrophoresis facilitated the interpretation of the results, an improvement over the standard agarose gel electrophoresis. Using GeneMapper Software, all loci were clearly identified on electropherograms according to their size ranges and colours, and the amplicon sizes allowed the determination of repeat number.

The regulation of sialometabolism gene expression is complex but there appears to be no major requirement for the positive (CRP-dependent) or negative (SiaR-dependent) transcriptional regulation on LPS sialylation in experimental OM

induced through direct inoculation of organisms into the middle ear of chinchillas. Acknowledgements GAJ and DWH were supported by grants from the Medical Research Council, UK and GAK from the Wellcome Trust. We thank Michael Apicella and Jason Johnston for helpful comments on the manuscript. References 1. Varki A: Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 1993,3(2):97–130.PubMedCrossRef 2. Hood DW, Makepeace K, Deadman ME, Rest RF, Sapitinib chemical structure Thibault P, Martin A, Richards JC, Moxon ER: Sialic acid in the lipopolysaccharide of Haemophilus influenzae: strain distribution, influence on serum resistance and structural characterization. Mol Microbiol 1999,33(4):679–692.PubMedCrossRef 3. Bouchet V, Hood DW, Li J,

Brisson JR, Randle GA, Martin A, Li Z, Goldstein R, Schweda EK, Pelton SI, et al.: Host-derived sialic acid is incorporated into Haemophilus influenzae lipopolysaccharide and is a major virulence factor in experimental otitis media. Proc Natl Acad Sci USA 2003,100(15):8898–8903.PubMedCrossRef 4. Jurcisek J, Greiner L, Watanabe SC79 H, Zaleski A, Apicella MA, Bakaletz LO: Role of sialic acid and complex carbohydrate biosynthesis in biofilm formation by nontypeable Haemophilus influenzae in the chinchilla middle ear. Infect Immun 2005,73(6):3210–3218.PubMedCrossRef 5. Figueira MA, Ram S, Goldstein R, Hood DW, Moxon ER, Pelton SI: Role of complement in defense of the middle ear revealed by restoring the virulence of nontypeable Haemophilus

influenzae siaB mutants. Infect Immun 2007,75(1):325–333.PubMedCrossRef 6. Swords WE, Moore PDK4 ML, Godzicki L, Bukofzer G, Mitten MJ, VonCannon J: Sialylation of lipooligosaccharides promotes biofilm formation by nontypeable Haemophilus influenzae. Infect Immun 2004,72(1):106–113.PubMedCrossRef 7. Greiner LL, Watanabe H, Phillips NJ, Shao J, Morgan A, Zaleski A, Gibson BW, Apicella MA: Nontypeable Haemophilus influenzae strain 2019 produces a biofilm containing N-acetylneuraminic acid that may mimic sialylated O-linked glycans. Infect Immun 2004,72(7):4249–4260.PubMedCrossRef 8. Vimr E, Lichtensteiger C, Steenbergen S: Sialic acid metabolism’s dual function in Haemophilus influenzae. Mol Microbiol 2000,36(5):1113–1123.PubMedCrossRef 9. Vimr ER, Kalivoda KA, Deszo EL, Steenbergen SM: Diversity of microbial sialic acid metabolism. Microbiol Mol Biol Rev 2004,68(1):132–153.PubMedCrossRef 10. Severi E, Randle G, Kivlin P, Whitfield K, Young R, Moxon R, Kelly D, Hood D, Thomas GH: Sialic acid transport in Haemophilus influenzae is essential for lipopolysaccharide sialylation and serum resistance and is dependent on a novel tripartite ATP-independent periplasmic transporter.

(C) Alignment of the multimer resolution sites. The ArgR, FIS, XerC and XerD binding sites are boxed and conserved A-T stretches responsible for DNA bending are underlined. The -10 and -35 boxes of the ColE1 P cer promoter are underlined and the start of the Rcd coding region is indicated by an arrow. Nucleotides conserved

in at least 50% of the sequences are shown in bold and invariant sites are marked with an asterisk. It might be thought surprising that all multimer resolution sites of plasmids depicted in Fig. 1 are in the same orientation with respect to the replication origin (oriV). This is also true for all ColE1-like plasmids in Fig. 2A. The explanation for this observation may lie in the intimate association of replication control and multimer resolution in the stable maintenance of ColE1-like plasmids. Because all of the ColE1 replication origins in a cell buy MK-8776 function independently, plasmid dimers (which have two origins) replicate twice as often as monomers. As a result, dimers accumulate rapidly and clonally in a process known as the dimer catastrophe [25]. RNAI-RNAII copy number control counts origins rather than plasmids, so a dimer is not differentiated from two monomers. Consequently the copy number (i.e the number of independent molecules) of dimers is approximately half that of monomers.

ColE1 lacks active MEK162 manufacturer partition, so plasmid stability requires the maintenance of a high copy number. As a result the copy number depression caused by dimer accumulation causes plasmid instability [26]. One part of the solution to this problem is the resolution of dimers or higher multimers to monomers by site-specific recombination. The multimer resolution site of ColE1 (designated cer, for ColE1 resolution) contains binding sites for the host-encoded recombinase

XerCD and the accessory protein ArgR (Fig. 2C). They act together with PepA (whose binding site is less clearly defined) to convert dimers to monomers by site-specific recombination [27–30]. Conserved A-T tracts phased at approximately 10.5 bp intervals facilitate the curvature of the region between the ArgR and XerC/XerD binding sites, which is thought to be beneficial for recombination complex formation [31, 32]. These sequence elements ioxilan are conserved in the mrs sites of the ColE1-like plasmids (Fig. 2C). Multimer resolution is necessary but not sufficient to combat the threat of the dimer catastrophe. A checkpoint, mediated by the small regulatory transcript Rcd, ensures that the cell does not divide before multimers have been resolved completely to monomers [33]. Rcd binds to the enzyme tryptophanase, stimulating the production of indole which inhibits cell division by an unknown mechanism [34]. Rcd is expressed from the P cer promoter within cer. P cer is active in plasmid multimers but is repressed in monomers by FIS and XerCD [35]. A FIS binding site important for regulation of P cer has been mapped recently [35] (Fig. 2C).

These results suggest that at the telomere level, the development BMS345541 purchase of HBV-associated cirrhosis includes strong hTERT overexpression and considerable repression of hTR, shelterin, and non-shelterin telomere factors. Similar results were obtained when the 8 HBV+ cirrhotic samples were compared with the 9 non-cirrhotic liver samples derived from patients with idiopathic

HCC (data not shown). Table 2 Cause-specific differences in telomeric gene expression between cirrhotic and non-cirrhotic liver samples   Non-cirrhotic Cirrhotic p   (n = 12) HBV (n = 8) HCV (n = 9) Alcohol (n = 10) For HBV For HCV For alcohol Shelterin POT1 0.0021 0.0000 0.0125 0.0090 0.0480 0.0100 0.0050 PTOP 0.0094 0.0000 0.0037 0.0055 0.0200 ns ns RAP1 0.1570 0.0016 0.4210 0.4091 0.0070 0.0080 0.0060 TIN2 0.3510 0.0018 0.0510 0.0804 0.0010 ns <10-4 TRF1 0.5585 0.0117 0.2271 0.2488 <10-4 ns ns TRF2 0.0016 0.0000 0.0016 SU5402 mouse 0.0012 0.0050 ns ns Non-Shelterin HMRE11A 0.0187 0.0006 0.0627 0.0764 ns ns 0.0070 HMRE11B 0.0359 0.0008 0.0492 0.0886 0.0030 ns 0.0020 Ku70 0.0955 0.0045 0.1704

0.1825 <10-4 ns 0.0440 Ku80 0.0408 0.0033 0.1209 0.1316 0.0200 0.0290 0.0120 NBS1 0.0266 0.0002 0.0304 0.0403 0.0030 ns ns RAD50 0.0030 0.0002 0.0091 0.0108 ns 0.0180 0.0500 TANK1 0.0468 0.0005 0.0788 0.0945 <10-4 ns 0.0030 TANK2 0.0129 0.0000 0.0188 0.0127 0.0200 ns ns Pinx1 0.0131 0.0001 0.0083 0.0219 Astemizole 0.0020 ns 0.0210 Telomere deregulation at the early stage of HCV-associated hepatocarcinogenesis Expression of the Ki67 proliferation marker was not significantly different between the 9 HCV positive cirrhotic samples and the 12 non-cirrhotic liver samples deriving from patients with HCC. There was no significant difference in the expression level of TA, hTERT and hTR between the two sample categories (Figure 1A). Western-blot analysis of hTERT expression confirmed the qRTPCR results for hTERT expression (Figure 2B). Shelterin, POT1 and repressor-activator protein 1 (RAP1) were demonstrated

to be significantly overexpressed in HCV positive cirrhotic samples when compared with non-cirrhotic liver samples. The remaining factors displayed an identical (TRF2) or a non-significant reduced expression level (Table 2). In contrast to HBV, all telomere factors except Pinx1 non-shelterin were overexpressed in cirrhotic peritumoral HCV positive samples, as compared to non-cirrhotic liver samples (Figure 1C, Table 2). Indeed, the expression of Ku80 (p = 0.029) and RAD50 (p = 0.018) was approximately 3 times higher than that of the control samples. Western-blots confirmed that POT1, HMRE11A/B, and KU80 were more expressed in HCV positive cirrhotic samples than in non-cirrhotic liver samples (Figure 2D).

The plot is located at lower energy density region near the 2nd Compound C clinical trial cells. It needs further improvement for energy density. Figure 3 Self-discharge curves and discharging behaviors. (a) Self-discharge curves after charging at current of 10 pA, 1 nA, 1 μA, 1 mA, and 100 mA for approximately 0.5 s. The inset shows the current effect on the charging time up to 10 V. (b) Discharging behaviors for voltage under constant currents of 1 mA, 10 mA, and 100 mA after 1.8-ks charging at 100 mA. Figure 4 Comparison of the power density and energy density. For EDCC, EDLC, batteries,

and fuel cells in Ragon plot (after Whittingham [20]). AC electric measurement of EDCC Capacitance as a function of frequency at room temperature is presented logarithmically in Figure 5a, along with those of the de-alloyed Si-20at%Al specimen [11]. Frequency dependent capacitances decreased parabolic from around 0.1 mF (0.54 F/cm3) to around 1.3 pF (53 μF/cm3) with increasing frequency and saturated from 0.1 to 0.4 nF in frequency region from 1 kHz to 1 MHz. The saturated values of the former are 30

times larger than those of the latter. This difference would be derived from higher absorbed electron density of the former, Endocrinology inhibitor accessible to electron trapping. Here it should be noted that charging/discharging of electrochemical cells occurs at lower frequency regions on the whole interfaces in pores of electrodes, but does not occur at higher frequency ones in interior parts of pores [21]. Hence, Chlormezanone by analogy we infer that that the de-alloyed and anodic oxidized Ti-Ni-Si material, which shows large frequency dependence on capacitance independent of temperature, is an assembly of canyons with the deepest recess. The whole behavior in Figure 5a implies ac current momentary (below 0.1 s) charging/discharging, with the observed decrease in capacitance come from dielectric dispersion by interfacial polarization. These results would be associated with electron storage in amorphous TiO2-x coated

solid cell without solvents. Furthermore, we can store electricity in ac current using a rectifier, if we could be taken a figure up three places over capacitance at higher frequencies. Figure 5 Frequency dependence of capacitance (a) and RC constant (b). For de-alloyed and anodic oxidized Ti-Ni-Si and de-alloyed Si-Al specimens in an input voltage of 10 V at room temperature. Figure 5b shows a frequency dependent RC constant in input voltage of 10 V at room temperature for the former and the latter [11]. The former’s RC decreases parabolically from around 800 s (13.1 min) to around 5 ms with increasing frequency up to 1 kHz at 100 ms-15 ns intervals, before becoming saturated in the frequency region from 1 kHz to 1 MHz. The 800 s (13.1 min) at 1 mHz is 157,000 times larger than that (5 ms) in the conventional EDLC [19]. However, it needs larger ones from 0.1 s to few hours for practical use.

Mol Microbiol 2002,46(3):601–610.PubMedCrossRef 30. Doublet B, Boyd D, Mulvey MR, Cloeckaert A: The Salmonella genomic island 1 is an integrative mobilizable element. Mol Microbiol 2005,55(6):1911–1924.PubMedCrossRef 31. Hochhut B, Waldor MK: Site-specific integration of the conjugal

Vibrio cholerae SXT element into prfC . Mol Microbiol 1999,32(1):99–110.PubMedCrossRef 32. Juhas M, van der Meer JR, Gaillard M, Harding RM, Hood DW, Crook DW: Genomic islands: tools of bacterial horizontal gene transfer and evolution. FEMS Microbiol Rev 2009,33(2):376–393.PubMedCrossRef 33. Schubert S, Dufke S, Sorsa J, Heesemann J: A novel integrative and conjugative https://www.selleckchem.com/products/iwr-1-endo.html element (ICE) of Escherichia coli : the putative progenitor of the Yersinia high-pathogenicity island. Mol Microbiol 2004,51(3):837–848.PubMedCrossRef 34. Bellanger X, Roberts AP, Morel C, Choulet F, Pavlovic G, Mullany P, Decaris B, Guedon G: Conjugative transfer of the integrative conjugative elements ICE St1 and ICE St3 from Streptococcus thermophilus . J Bacteriol 2009,191(8):2764–2775.PubMedCrossRef 35. Coburn PS, Baghdayan STAT inhibitor AS, Dolan GT, Shankar N: Horizontal transfer of virulence genes encoded on the Enterococcus faecalis

pathogenicity island. Mol Microbiol 2007,63(2):530–544.PubMedCrossRef 36. Qiu X, Gurkar AU, Lory S: Interstrain transfer of the large pathogenicity island (PAPI-1) of Pseudomonas aeruginosa . Proc Natl Acad Sci USA 2006,103(52):19830–19835.PubMedCrossRef

Interleukin-3 receptor 37. Carter MQ, Chen J, Lory S: The Pseudomonas aeruginosa pathogenicity island PAPI-1 is transferred via a novel type IV pilus. J Bacteriol 2010,192(13):3249–3258.PubMedCrossRef 38. Franco AA: The Bacteroides fragilis pathogenicity island is contained in a putative novel conjugative transposon. J Bacteriol 2004,186(18):6077–6092.PubMedCrossRef 39. Kienesberger S, Trummler CS, Fauster A, Lang S, Sprenger H, Gorkiewicz G, Zechner EL: Interbacterial macromolecular transfer by the Campylobacter fetus subsp. venerealis type IV secretion system. J Bacteriol 2011,193(3):744–758.PubMedCrossRef 40. Roche D, Flechard M, Lallier N, Reperant M, Bree A, Pascal G, Schouler C, Germon P: ICE Ec2 , a new integrative and conjugative element belonging to the pKLC102/PAGI-2 family, identified in Escherichia coli strain BEN374. J Bacteriol 2010,192(19):5026–5036.PubMedCrossRef 41. Daccord A, Ceccarelli D, Burrus V: Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol 2010,78(3):576–588.PubMedCrossRef 42. Laverde Gomez JA, van Schaik W, Freitas AR, Coque TM, Weaver KE, Francia MV, Witte W, Werner G: A multiresistance megaplasmid pLG1 bearing a hyl Efm genomic island in hospital Enterococcus faecium isolates. Int J Med Microbiol 2011,301(2):165–175.PubMedCrossRef 43.

3 (equilibrium spacing for the Lennard-Jones potential of the surfaces, nm) [29], K = 55.4 (combined elastic modulus, GPa), η = 0.2 (Tabor’s coefficient). Experimentally observed trace areas remained after ND displacement; contact areas calculated for the same NDs according to the FDM (Equation 3) and DMT (Equation 6) approaches using radii of ND end bulbs, measured

in SEM, are shown in Figure 6. It is evident that experimental Selleckchem AZD8931 results obtained by trace observations are closer to values of contact area calculated by FDM than to those by the DMT-M model (Figure 6). It means that the end bulbs of these NDs are not perfect spheroids, but truncated ones solidified in the contact with the substrate. However, the obtained experimental values are AZD2171 still lower

than FDM predicts. The possible reasons for FDM to overestimate the contact area are as follows: (1) the equilibrium shape of the droplet may differ significantly from the truncated spheroid, (2) the droplet solidifies before reaching the equilibrium shape, (3) it is possible that the contact angle of the substrate surface with liquid metal nanodroplets is larger than the contact angle of that with macroscopic droplets (135° to 150° instead of 123.8°). A phenomenon directly related to variations in friction force and contact area is a temporal dependence of contact area or aging [15, 30]. The force required to displace NDs was inversely proportional to the time intervals between the manipulation events. Figure 5c demonstrates the traces left after

the first and the second displacement of the same ND (time interval of a few minutes). The area of the first pair of traces is approximately 9.03 × 103 and 10.82 × 103 nm2 and only approximately DOCK10 2.63 × 103 and 2.62 × 103 nm2 for the second pair of traces. Analysis of the shape of this ND before and after displacement provides evidence that ND was displaced by sliding and rotation only. Therefore, the decrease of the contact area in this case cannot be explained by rolling of the ND onto the more spherical side of the end bulbs. Possible explanation of contact aging is diffusion of metal atoms, which can be accelerated by local heating or migration of electrons caused by the electron beam of SEM. However, detailed analysis of the contact aging phenomenon is out of the scope of this article. Conclusions It was demonstrated that metal NDs are attractive objects for nanomanipulation and nanotribology. Formation of metal ND on the substrate from a NW under laser beam radiation is a complex process. The final configuration of a ND is a result of the interplay between the intrinsic effects (i.e. melting, crystallization, effect of thermal stress, elastic forces) and adhesion during the separation of the NW from the substrate. The experimental study showed reduced contact area and adhesion of NDs in comparison to intact NWs.

Acta Mater 2008, 56:2929–2936.CrossRef 5. Hu N, Karube Y, Arai M, Watanabe T, Yan C,

Li Y, Liu Y, Fukunaga H: Investigation on sensitivity of a polymer/carbon nanotube composite strain sensor. Carbon 2010, 48:680–687.CrossRef 6. Seidel GD, Stephens SN: Analytical and computational micromechanics analysis of the effects of interphase regions on the effective coefficient of thermal expansion of carbon nanotube-polymer nanocomposites. In Proceedings of the FK228 in vivo 51st AIAA/ASME/ASCE/AHS/ASC Structures, Structural Dynamics, and Materials Conference: April 12–15 2010; Orlando. Reston: AIAA; 2010:2010–2809. 7. Wei C: Thermal expansion and diffusion coefficients of carbon nanotube-polymer composites. Nano Lett 2002, 2:647–650.CrossRef 8. Hu N, Fukunaga H, Lu C, Kameyama M, Yan B: Prediction of elastic properties of carbon nanotube-reinforced composites. Proc R Soc Lond A Math Phys Sci 2005, 461:1685–1710.CrossRef 9. Hu B, Hu N, Li Y, Akagi K,

Yuan W, Watanabe T, Cai Y: Multi-scale numerical simulations on piezoresistivity of CNT/polymer nanocomposites. Nanoscale Res Lett 2012, 7:402.CrossRef 10. Clancy TC, Frankland SJV, Hinkley JA, Gates TS: Multiscale modeling of thermal conductivity of polymer/carbon nanocomposites. Int J Therm Sci 2010, 49:1555–1560.CrossRef 11. Park C, Wilkinson J, Banda S, Ounaies Z, Wise KE, Sauti see more G, Lillehei PT, Harrison JS: Aligned single wall carbon nanotube polymer composites using an electric field. J Polym Sci, Part B: Polym Phys 2006, 44:1751–1762.CrossRef 12. Okabe T, Motani T, Nishikawa M, Hashimoto M: Numerical simulation of microscopic damage and strength of fiber-reinforced plastic composites. Adv Compos Mater 2012, 21:147–163.CrossRef 13. Huang H, Talreja R: Numerical simulation of matrix micro-cracking in short fiber reinforced polymer composites: initiation and propagation. Compos Sci Technol 2006, 66:2743–2757.CrossRef 14. Alamusi , Hu N, Jia B, Arai M, Yan C, Li J, Liu Y, Atobe S, Fukunaga H: Prediction of thermal expansion properties of carbon nanotubes using molecular dynamics simulations.

Comput Mater Sci 2012, 54:249–254.CrossRef 15. Yamamoto G, Liu S, Hu N, Hashida T, Liu Y, Yan C, Li Y, Cui H, Ning H, Wu L: Prediction of pull-out force of multi-walled carbon nanotube (MWCNT) in sword-in-sheath mode. Comput Mater Sci 2012, 60:607–612.CrossRef 16. Hu N, Fukunaga H, Lu C, Kameyama M, Yan B: Prediction of else elastic properties of carbon nanotube-reinforced composites. Proc R Soc A 2005, 461:1685–1710.CrossRef 17. Hu N, Wang B, Tan GW, Yao ZH, Yuan W: Effective elastic properties of 2-D solids with circular holes: numerical simulations. Compos Sci Technol 2000, 60:1811–1823.CrossRef 18. Wang YQ, Zhang MD, Zhou BL, Shi CX: A theoretical model of composite thermal expansion. Mater Sci Prog 1989, 3:442–446. 19. Hu N, Masuda Z, Yamamoto G, Fukunaga H, Hashida T, Qiu J: Effect of fabrication process on electrical properties of polymer/multi-wall carbon nanotube nanocomposites. Composites: Part A 2008, 39:893–903.

However, not all observed pairwise residue correlations in adjacent repeats are entirely well-explained within the context of the presented structural CP-868596 mw model. In addition we have no plausible explanation for why only FliH proteins, and no other sequences, contain these unique GxxxG repeats. There is also no obvious reason or explanation for the highly variable number of repeats in different FliH sequences. However, sequence deletions in Salmonella FliH that affect

in vitro ATPase hydrolysis assays for a FliI:FliH complex (either by enhancing or reducing FliI’s ATPase activity) overlap with one or more of the Salmonella FliH GxxxG repeats (see introduction) [17]. This suggests that secondary interactions

between FliI and FliH, in addition to the well-known interaction between the C-domain of FliH and the N-terminal 15 residues of FliI, may depend critically on the presence of the GxxxG motif [15, 18]. Studies on the ATPase activities and/or export capability of FliI:FliH pairs from other motile bacteria with engineered deletions in the FliH GxxxG repeats would likely shed light on the importance of the GxxxG repeats in flagellar protein export. While the extremely long length of the repeats in some FliH proteins implies that the repeats may cooperate to perform an important functional or structural role, the fact that other FliH sequences have short repeats segments, or even no repeat segment at all, would suggest otherwise. NSC 683864 molecular weight Alternately, another unidentified protein involved in the flagellum export pathway may be able to compensate for deletion of the GxxxG motifs in Suplatast tosilate FliH. Given the likely structural constraints on FliH participating in the flagellar export pathway via interactions with FliI, FliN and other proteins at the base of the flagellar export pore, it will be interesting to see if more

than one protein participates in interactions with the FliH GxxxG motifs. It is also interesting that extremely long glycine repeats evolved in FliH, but not in its Type III secretion homologue YscL, and this may actually tell us something, albeit cryptically, about differences in the two export systems. The extremely biased amino acid composition of the glycine repeats suggests that these regions may adopt nonstandard helix-helix tertiary or quaternary interactions that will be of interest for structural biologists to elucidate. Lastly, and perhaps most interestingly, the extreme rarity of this motif in other proteins is very surprising given that nature tends to find similar structural solutions to a biological problem multiple times. Crystal structures and careful biochemical/biological analysis of these proteins should ultimately be able to address these fascinating issues. Methods Acquiring the set of FliH proteins We endeavored to acquire FliH proteins from as many different bacterial species as possible.